Illustration of a DNA double helix in blue tones

The human reference genome

One reference. Three billion letters. Infinite questions.

Omicser helps researchers orient themselves in genomic context before drawing conclusions.

Start here

The human genome, before any interpretation

Understanding scale and structure comes first. Numbers alone do not explain what a change in the sequence means.

~3 billion

DNA base pairs

The human reference genome spans roughly three billion base pairs of DNA across the nuclear genome.

23 pairs

Chromosomes

That sequence is organised into 23 pairs of chromosomes, one set inherited from each parent.

< 2%

Protein-coding DNA

Less than two percent of the genome directly codes for protein; much of the rest is regulatory or still poorly understood.

A variant only carries meaning in context

Genomic context

Where a variant sits — coding, regulatory, intronic or intergenic — changes what it could do.

Tissue context

A regulatory effect may appear in one tissue and be entirely absent in another.

Inheritance context

Zygosity, parental origin and family history shape how an observation should be read.

Evidence context

Published, reproducible primary evidence decides whether an interpretation holds at all.

Explore the complete Human Genome guide

Who we are

Omicser is a personalized research guide

Built by Madomic Kalin — Modern Applications for Diagnostics of Microbiology — Omicser supports researchers globally who need orientation, not verdicts. It explains where to look, what context matters and how to verify, for research and education only.

Genomics

Madomic Gene Engine

Navigate the GRCh38 reference, simulate a single-nucleotide substitution, run it through public research databases, compare results and export an auditable record. Research and education use only — no real genome is modified.

Interactive research service

Madomic Gene Engine — variant simulation workspace

Test a single-nucleotide substitution against the GRCh38 reference and read what public research databases return for it. Nothing here edits, changes or engineers a real human genome. Research and education use only. Not clinical interpretation, diagnosis, treatment, genetic counselling or a laboratory report. Each variant is a simulation tested against the GRCh38 reference — no real human genome is modified.

Madomic Research NetworkEnsembl REST — awaiting requestAlphaGenome — ready for private service

Nucleotide substitution builder — simulation only

Reference assembly: GRCh38 / GCA_000001405.15 · chr7 RefSeq NC_000007.14

Alternate base
chrN:POSITION REF>ALT

Fetch the reference base for this coordinate before checking the substitution.

Variant comparison — this session

Each variant is evaluated independently against the same GRCh38 reference. Rows are not cumulative edits. History lives in browser memory only and clears on reset or refresh unless you download it.

No variants checked yet. Build a substitution above and select “Check this change”.

Build a substitution and select “Check this change”. Only the constructed variant text is sent to the Omicser server; no other data is transmitted or stored.

Madomic Gene Engine is an independent explanatory research layer for variant simulation against the public GRCh38 reference. It is not affiliated with, endorsed by, or a replacement for Google DeepMind, AlphaGenome Atlas, a genetics professional, or a diagnostic laboratory. No ACMG/AMP or ClinGen classification is produced. Never enter or upload patient data. Eligibility and use remain subject to the current AlphaGenome Terms and Output Terms.

Illustrative chromosome ideogram

query region

Illustrative sequence track

ACGTTGCAACGTAGGCTTACGATCGGATCCA

Schematic visualisation only — no scientific results are shown or implied.

Looking ahead

Future service roadmap

All roadmap items are planned concepts — they are not currently available clinical or diagnostic services.

Concept 01Planned concept

Research navigation

Structured routes through public genomic resources so a research question is framed before any data is interpreted.

Concept 02Planned concept

Maps, comparative genomics and phylogenetics

Richer genome maps and comparative visualisations across species to support evolutionary and structural reasoning.

Concept 03Planned concept

Multi-omics study support

Guidance for designing studies that combine transcriptomic, proteomic and metabolomic layers.

Concept 04Planned concept

Possible future laboratory services

Exploratory laboratory collaboration formats, subject to regulatory, ethical and quality frameworks.

Attribution

Scientific sources

Omicser references publicly available AlphaGenome work. It is independent of, and not endorsed by, Google DeepMind.